ID: 1007478809_1007478823

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1007478809 1007478823
Species Human (GRCh38) Human (GRCh38)
Location 6:42136722-42136744 6:42136772-42136794
Sequence CCAGTCTTTCCCAGCAAGTCCCA GGCCTTTGTCCAAGGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 292} {0: 1, 1: 0, 2: 1, 3: 100, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!