ID: 1007498567_1007498574

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1007498567 1007498574
Species Human (GRCh38) Human (GRCh38)
Location 6:42278938-42278960 6:42278981-42279003
Sequence CCTGTCATCCTTTACAGTCTTTT CCTTCTATGCCAGGGCTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 266} {0: 1, 1: 0, 2: 2, 3: 22, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!