ID: 1007499693_1007499697

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1007499693 1007499697
Species Human (GRCh38) Human (GRCh38)
Location 6:42287475-42287497 6:42287506-42287528
Sequence CCGAAAGGCCTCTGTCTCAGCAG GACCCCTGCTTCACAGAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 247} {0: 1, 1: 0, 2: 1, 3: 26, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!