ID: 1007512138_1007512149

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1007512138 1007512149
Species Human (GRCh38) Human (GRCh38)
Location 6:42381761-42381783 6:42381797-42381819
Sequence CCTCCTGGGAGAAGCAGAGCCCA GAGAAGTATTCAAGCACAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 355} {0: 1, 1: 0, 2: 1, 3: 13, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!