ID: 1007556204_1007556217

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1007556204 1007556217
Species Human (GRCh38) Human (GRCh38)
Location 6:42768661-42768683 6:42768708-42768730
Sequence CCTTCTCCCCTCCATGCCCAGTG CCCAATCACTGGTCCTTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 94, 4: 660} {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!