ID: 1007566100_1007566104

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1007566100 1007566104
Species Human (GRCh38) Human (GRCh38)
Location 6:42851713-42851735 6:42851735-42851757
Sequence CCCACATAGGAGCTGATAGTCAG GGATCATAATCCTAGCAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97} {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!