ID: 1007569392_1007569394

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1007569392 1007569394
Species Human (GRCh38) Human (GRCh38)
Location 6:42878681-42878703 6:42878712-42878734
Sequence CCAGGCTGGAGTGCAAGTGGCAC CTCACGCAGCCTCCGCCTTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 32, 3: 192, 4: 694}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!