ID: 1007589161_1007589171

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1007589161 1007589171
Species Human (GRCh38) Human (GRCh38)
Location 6:43011203-43011225 6:43011253-43011275
Sequence CCCCAGGACGTGTACACCATCAA AGAGTTCCTAACTGCCAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51} {0: 1, 1: 0, 2: 4, 3: 10, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!