ID: 1007600152_1007600161

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1007600152 1007600161
Species Human (GRCh38) Human (GRCh38)
Location 6:43076331-43076353 6:43076356-43076378
Sequence CCGGCTCGGGACGCCTCGGGACG TCGGGGTCGGGCTCCGGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56} {0: 1, 1: 0, 2: 12, 3: 65, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!