ID: 1007603204_1007603210

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1007603204 1007603210
Species Human (GRCh38) Human (GRCh38)
Location 6:43096700-43096722 6:43096733-43096755
Sequence CCTGGGCTAGCCTGGGCACCTGC GGCCAGCCTGCCTGCCTGTCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 85, 4: 489}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!