ID: 1007623033_1007623042

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1007623033 1007623042
Species Human (GRCh38) Human (GRCh38)
Location 6:43226370-43226392 6:43226393-43226415
Sequence CCTGTCACCCCCAGCAGCCTCTT CCCCTGTGTTGAGGGAAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 421} {0: 1, 1: 0, 2: 0, 3: 20, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!