ID: 1007628149_1007628159

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1007628149 1007628159
Species Human (GRCh38) Human (GRCh38)
Location 6:43258123-43258145 6:43258170-43258192
Sequence CCACCCTCAATCTGAGCATAGAG TTTAACCTTAGTGGGTCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104} {0: 1, 1: 0, 2: 2, 3: 5, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!