ID: 1007628149_1007628161

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1007628149 1007628161
Species Human (GRCh38) Human (GRCh38)
Location 6:43258123-43258145 6:43258172-43258194
Sequence CCACCCTCAATCTGAGCATAGAG TAACCTTAGTGGGTCCCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104} {0: 1, 1: 0, 2: 0, 3: 3, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!