ID: 1007631403_1007631418

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1007631403 1007631418
Species Human (GRCh38) Human (GRCh38)
Location 6:43275352-43275374 6:43275391-43275413
Sequence CCCCCGCCGCCCCCGTCGCCCCG CGTTTGCTTTTCCCTGCTGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!