ID: 1007631409_1007631418

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1007631409 1007631418
Species Human (GRCh38) Human (GRCh38)
Location 6:43275362-43275384 6:43275391-43275413
Sequence CCCCGTCGCCCCGCCTTCGCGCC CGTTTGCTTTTCCCTGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 199} {0: 1, 1: 0, 2: 2, 3: 13, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!