ID: 1007631411_1007631419

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1007631411 1007631419
Species Human (GRCh38) Human (GRCh38)
Location 6:43275364-43275386 6:43275395-43275417
Sequence CCGTCGCCCCGCCTTCGCGCCCG TGCTTTTCCCTGCTGCTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 178} {0: 1, 1: 0, 2: 4, 3: 41, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!