ID: 1007631413_1007631427

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1007631413 1007631427
Species Human (GRCh38) Human (GRCh38)
Location 6:43275371-43275393 6:43275420-43275442
Sequence CCCGCCTTCGCGCCCGTTTTCGT GCCTTTGGGTCCCTGGCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 20} {0: 1, 1: 0, 2: 4, 3: 48, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!