ID: 1007636741_1007636752

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1007636741 1007636752
Species Human (GRCh38) Human (GRCh38)
Location 6:43304175-43304197 6:43304223-43304245
Sequence CCGCCCTCCTGCTGCCAGAGACG TCCAGGACGTGGAGAGAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 272} {0: 1, 1: 0, 2: 3, 3: 22, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!