ID: 1007643317_1007643320

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1007643317 1007643320
Species Human (GRCh38) Human (GRCh38)
Location 6:43361210-43361232 6:43361242-43361264
Sequence CCTAAAGAAAATCAGAGGGAAAA TCCTTCAATCTGTCAGAATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 109, 4: 948} {0: 1, 1: 0, 2: 1, 3: 16, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!