ID: 1007666538_1007666551

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1007666538 1007666551
Species Human (GRCh38) Human (GRCh38)
Location 6:43516811-43516833 6:43516858-43516880
Sequence CCTTGAGGGCTCCCGTCGCTGAA GTGGGCAAGATGTGGGCCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 45} {0: 1, 1: 1, 2: 8, 3: 28, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!