ID: 1007666542_1007666552

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1007666542 1007666552
Species Human (GRCh38) Human (GRCh38)
Location 6:43516835-43516857 6:43516862-43516884
Sequence CCCGCGCTAGCCCCGCGCGCGGA GCAAGATGTGGGCCTCCGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 76} {0: 1, 1: 0, 2: 0, 3: 2, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!