ID: 1007666543_1007666549

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1007666543 1007666549
Species Human (GRCh38) Human (GRCh38)
Location 6:43516836-43516858 6:43516850-43516872
Sequence CCGCGCTAGCCCCGCGCGCGGAG CGCGCGGAGTGGGCAAGATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 79} {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!