|
Left Crispr |
Right Crispr |
| Crispr ID |
1007685819 |
1007685820 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:43666773-43666795
|
6:43666788-43666810
|
| Sequence |
CCATATATATACATATATTTGAG |
TATTTGAGACAGAGTCTCGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 20, 3: 200, 4: 1382} |
{0: 2, 1: 30, 2: 135, 3: 336, 4: 688} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|