ID: 1007686085_1007686098

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1007686085 1007686098
Species Human (GRCh38) Human (GRCh38)
Location 6:43668137-43668159 6:43668180-43668202
Sequence CCTGCAGCACCAAGTCTGCAGGG AGGCGGTGACAGCAGCTGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 30, 4: 438}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!