ID: 1007701068_1007701070

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1007701068 1007701070
Species Human (GRCh38) Human (GRCh38)
Location 6:43766971-43766993 6:43766986-43767008
Sequence CCACCGGCTTCTAGATTAACCAC TTAACCACCCACACCCACACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 9, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!