ID: 1007702272_1007702284

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1007702272 1007702284
Species Human (GRCh38) Human (GRCh38)
Location 6:43772065-43772087 6:43772095-43772117
Sequence CCCCCGCCAGCCCTCCGCGGGAA TCTCGAGGTAGCCCCAGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 129} {0: 1, 1: 0, 2: 2, 3: 15, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!