ID: 1007736114_1007736132

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1007736114 1007736132
Species Human (GRCh38) Human (GRCh38)
Location 6:43983307-43983329 6:43983344-43983366
Sequence CCTGAGTCCCTCTGCTCACAGTG GCCTGGGGGTGGGAAGGGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 23, 3: 139, 4: 1167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!