ID: 1007756840_1007756842

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1007756840 1007756842
Species Human (GRCh38) Human (GRCh38)
Location 6:44104979-44105001 6:44104998-44105020
Sequence CCACCACAGGTCAGTGCAGCAGA CAGAAAAAGCAGAAGAAATGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 6, 3: 112, 4: 1184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!