ID: 1007759971_1007759976

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1007759971 1007759976
Species Human (GRCh38) Human (GRCh38)
Location 6:44127851-44127873 6:44127870-44127892
Sequence CCATCCCGAGCCAAATGTGAGTC AGTCCTCCAACCCCTGCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!