ID: 1007760022_1007760024

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1007760022 1007760024
Species Human (GRCh38) Human (GRCh38)
Location 6:44127990-44128012 6:44128003-44128025
Sequence CCGGTGCAGGTGCGCGTCCCCTG GCGTCCCCTGCGCGACCCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 119} {0: 1, 1: 0, 2: 1, 3: 8, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!