ID: 1007761268_1007761280

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1007761268 1007761280
Species Human (GRCh38) Human (GRCh38)
Location 6:44135003-44135025 6:44135045-44135067
Sequence CCCTCTTCCCTCAGGCACTGCTG GGAAGGTGGCCTGGGACTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 413} {0: 1, 1: 0, 2: 1, 3: 18, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!