ID: 1007761856_1007761866

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1007761856 1007761866
Species Human (GRCh38) Human (GRCh38)
Location 6:44137993-44138015 6:44138045-44138067
Sequence CCTGGCCGGAGGTGGGGAGATAC GTCCTTCTGGGGTAGACTAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 4, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!