ID: 1007767826_1007767832

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1007767826 1007767832
Species Human (GRCh38) Human (GRCh38)
Location 6:44171371-44171393 6:44171394-44171416
Sequence CCTGCTGGGGCACATACTGAGCC CTGGGTCCCCAATATAATGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 3, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!