ID: 1007768665_1007768676

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1007768665 1007768676
Species Human (GRCh38) Human (GRCh38)
Location 6:44176687-44176709 6:44176723-44176745
Sequence CCACCCTAGGCCCTGGTCCTTCA CTCCTCTCTGTGCCTTGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 247} {0: 1, 1: 0, 2: 2, 3: 32, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!