ID: 1007771094_1007771095

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1007771094 1007771095
Species Human (GRCh38) Human (GRCh38)
Location 6:44192897-44192919 6:44192910-44192932
Sequence CCTGCACAAGAGTGTGTTGACTA GTGTTGACTAAAGCAACCAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!