ID: 1007779708_1007779716

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1007779708 1007779716
Species Human (GRCh38) Human (GRCh38)
Location 6:44245986-44246008 6:44246019-44246041
Sequence CCTCCAAGAGCTCCGGCTGCCCT CCAGAGACTCCCTCCTTCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 54, 4: 421}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!