ID: 1007779709_1007779721

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1007779709 1007779721
Species Human (GRCh38) Human (GRCh38)
Location 6:44245989-44246011 6:44246035-44246057
Sequence CCAAGAGCTCCGGCTGCCCTGCA TCCCAGGTCCAAATGGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 40, 4: 410} {0: 1, 1: 0, 2: 2, 3: 26, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!