ID: 1007779711_1007779721

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1007779711 1007779721
Species Human (GRCh38) Human (GRCh38)
Location 6:44245998-44246020 6:44246035-44246057
Sequence CCGGCTGCCCTGCACTGGTTCCC TCCCAGGTCCAAATGGCTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 26, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!