ID: 1007825413_1007825425

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1007825413 1007825425
Species Human (GRCh38) Human (GRCh38)
Location 6:44596191-44596213 6:44596228-44596250
Sequence CCTTCCTCCCTCCATATCCTTAG TGGGACCCTTTGGAGTTGAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!