ID: 1007825505_1007825512

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1007825505 1007825512
Species Human (GRCh38) Human (GRCh38)
Location 6:44597173-44597195 6:44597225-44597247
Sequence CCCCCTACCAGCAGTGTATGAGG TTTGAGACAGCCTGTTGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 40, 4: 213} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!