ID: 1007843225_1007843229 |
View in Genome Browser |
Spacer: 5 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1007843225 | 1007843229 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:44733679-44733701 | 6:44733707-44733729 |
| Sequence | CCCTAACTTGGCAGTGGGTGACT | TCCTCACATGCTCTGGAGGATGG |
| Strand | - | + |
| Off-target summary | No data | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||