ID: 1007888160_1007888170

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1007888160 1007888170
Species Human (GRCh38) Human (GRCh38)
Location 6:45256362-45256384 6:45256414-45256436
Sequence CCCCATGAATGATGATTTCTCTG TCCCTCAAGCCTCTTTTATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 249} {0: 24, 1: 77, 2: 242, 3: 596, 4: 1262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!