ID: 1007919947_1007919954

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1007919947 1007919954
Species Human (GRCh38) Human (GRCh38)
Location 6:45597969-45597991 6:45598021-45598043
Sequence CCTTTCTTGTCCATAAATCAAAT GAGCCACTCCTTCTTCCAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 271} {0: 1, 1: 0, 2: 1, 3: 15, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!