ID: 1007930232_1007930242

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1007930232 1007930242
Species Human (GRCh38) Human (GRCh38)
Location 6:45684276-45684298 6:45684317-45684339
Sequence CCATAATACCCCCATTTGAAATA ACTGCTCAAAGTCATATAGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!