ID: 1007951490_1007951495

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1007951490 1007951495
Species Human (GRCh38) Human (GRCh38)
Location 6:45876516-45876538 6:45876556-45876578
Sequence CCTCCTTTTTTTCTCTCTCTCTC TGTGAGATAATGCATCAAGAAGG
Strand - +
Off-target summary {0: 2, 1: 51, 2: 457, 3: 2589, 4: 11413} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!