ID: 1007967627_1007967634

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1007967627 1007967634
Species Human (GRCh38) Human (GRCh38)
Location 6:46016357-46016379 6:46016384-46016406
Sequence CCACCAAAAGGGGCATTTGCCAT GGGCTAAGCAAAAGGAGAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 126} {0: 1, 1: 1, 2: 0, 3: 18, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!