ID: 1007989369_1007989373

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1007989369 1007989373
Species Human (GRCh38) Human (GRCh38)
Location 6:46239328-46239350 6:46239381-46239403
Sequence CCAGGGAATTCAGTCCTTTGTAA CATGAGCTCCTATTGAACTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 158} {0: 1, 1: 0, 2: 1, 3: 6, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!