ID: 1007989584_1007989586

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1007989584 1007989586
Species Human (GRCh38) Human (GRCh38)
Location 6:46241160-46241182 6:46241182-46241204
Sequence CCATTTTCTGCTGATTGGTGGAG GATAAGCTATTTTGCCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 1017} {0: 1, 1: 0, 2: 0, 3: 10, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!