ID: 1007995364_1007995373

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1007995364 1007995373
Species Human (GRCh38) Human (GRCh38)
Location 6:46302194-46302216 6:46302236-46302258
Sequence CCATCTGTGGCCTGAGCAACTGG CCTGAAATGGAGAAAATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!