ID: 1007996413_1007996419

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1007996413 1007996419
Species Human (GRCh38) Human (GRCh38)
Location 6:46312807-46312829 6:46312849-46312871
Sequence CCGCCTCCTCATCTGTTAATAGA CTGCTCCCTACTTGGCATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 277} {0: 1, 1: 0, 2: 2, 3: 18, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!